View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_112 (Length: 225)
Name: NF1412_low_112
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_112 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 207
Target Start/End: Original strand, 510188 - 510381
Alignment:
| Q |
13 |
agcagagaagacccaagcagcactgaaatacaataatttcaaacaaacgtcagtatactatactattaattacattcttgataaatgtcaaagtgattga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
510188 |
agcagagaagacccaagcagcactgaaatacaataatttcaaacaaacgtcagtatactatactattaattacattcttgataaatgtcaaagtggttga |
510287 |
T |
 |
| Q |
113 |
attgaagacagaagatgtttttgcgtgcataaaggattacattgcattatagagaagaagaatagctatttgaacattcattcaagttgagcttc |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
510288 |
attgaagacagaagatg-ttttgcgtgcataaaggattacattgcattatagagaagaagaatagctatttgaacattcattcaagttgagcttc |
510381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University