View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_115 (Length: 222)
Name: NF1412_low_115
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_115 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 222
Target Start/End: Complemental strand, 48670747 - 48670530
Alignment:
| Q |
5 |
caataattccagcactacaacccatgccaccaagattataactcaaaatatttcccctcatcttataatgatttataatcatggctgacaatgatggtgt |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48670747 |
caataattccagcactacaacccataccaccaagattataactcaaaatatttcccctcatcttataatgatttataatcatggctgacaatgatggtgt |
48670648 |
T |
 |
| Q |
105 |
tggattgaatatgctacaatttactacaagaacaccaacatcttttggtctaattcctgttttttcaaagagttcatcaagtgctccaaacataaccatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48670647 |
tggattgaatatgctacaatttactacaagaacaccaacatcttttggtctaattcctgttttttcaaagagttcatcaagtgctccaaacataaccatt |
48670548 |
T |
 |
| Q |
205 |
gatgcctcagctctacct |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48670547 |
gatgcctcagctctacct |
48670530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 13 - 110
Target Start/End: Complemental strand, 15237261 - 15237164
Alignment:
| Q |
13 |
ccagcactacaacccatgccaccaagattataactcaaaatatttcccctcatcttataatgatttataatcatggctgacaatgatggtgttggatt |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||| |||| |||||||||||| | ||||||||| || | |||||||||||||| |
|
|
| T |
15237261 |
ccagcactacaacccataccaccaagattataactcaagatatttcctctcaacttataatgattcacaatcatggcagaaagagatggtgttggatt |
15237164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 34052096 - 34052056
Alignment:
| Q |
7 |
ataattccagcactacaacccatgccaccaagattataact |
47 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34052096 |
ataagtccagcactacaacccataccaccaagattataact |
34052056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University