View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_119 (Length: 214)
Name: NF1412_low_119
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_119 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 197
Target Start/End: Complemental strand, 5891252 - 5891062
Alignment:
| Q |
7 |
ggtagataattctgcatagacttccaactcctgggaacttataaaagaggggaattcttggagaggatggtttgacaaattgtgtttggtgtgaggaaaa |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5891252 |
ggtagttatttctgcatagacttccaactcctaggaacttataaaagaggggaattcttggagaggatggtttgacaaattgtgtttggtgtgaggaaaa |
5891153 |
T |
 |
| Q |
107 |
tggtagaagaggcagaccgtctcttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtgggtacgtgtgtgat |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5891152 |
tggtaaaagaggcagaccgtctcttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtgggtacgtgtgtgat |
5891062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 187
Target Start/End: Complemental strand, 34666849 - 34666748
Alignment:
| Q |
85 |
attgtgtttggtgtgaggaaaatggtagaagaggcagaccgtctcttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtgg |
184 |
Q |
| |
|
||||||||| ||||| ||||| || ||||||||| ||| | ||| ||||||| || || |||||||| || |||||| |||||||||||||| ||||| |
|
|
| T |
34666849 |
attgtgtttagtgtgtggaaa-tgatagaagaggaagatcatcttttttgtatgtatggttttgccgcatcgatttggtgtcatattttcaagttggtgg |
34666751 |
T |
 |
| Q |
185 |
gta |
187 |
Q |
| |
|
||| |
|
|
| T |
34666750 |
gta |
34666748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 6697611 - 6697664
Alignment:
| Q |
130 |
ttttgtaggtgtgattttgccgattcagtttggtatcatattttcaagtgggtg |
183 |
Q |
| |
|
|||| |||||||| |||||||| || |||||||||||||||||||||| |||| |
|
|
| T |
6697611 |
ttttataggtgtggttttgccggatcggtttggtatcatattttcaagtaggtg |
6697664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University