View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_120 (Length: 214)
Name: NF1412_low_120
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_120 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 47850340 - 47850141
Alignment:
| Q |
1 |
tgcgaacccaaatcatctgtgctgtagcctaatagtgttgtggaatttgatttaatcgctatcatttagcgatactctatttagcacaaacctctatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47850340 |
tgcgaacccaaatcatctgtgctgtagcctaatagtgttgtggaatttgatttaatcgctatcatttagcgatactctatttagcacaaacctctatagc |
47850241 |
T |
 |
| Q |
101 |
attcttgcatagagaaatttgaacatacctctatttccgcaatccatggttgacagttgattttgatagtcaaggtttgcgccttttgtgctcctgtttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47850240 |
attcttgcatagagaaatttgaacatacctc--tttccgcaatccatggttgacaattgattttgatagtcaaggtttgcgccttttgtgctcctttttg |
47850143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University