View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_20 (Length: 383)
Name: NF1412_low_20
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 283
Target Start/End: Original strand, 19388175 - 19388440
Alignment:
| Q |
18 |
ggatcaagtgaaccttgacggaaagccaatcgcaccgatctcaatatgcttgatcggcggtggaggattcatcggatcacacctcaccgaaaagctcatg |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19388175 |
ggatcgagtgaaccttgacggaaagccaattgtgccgatctcaatatgcttgatcggcggtggaggattcatcggatcacacctcaccgaaaagctcatg |
19388274 |
T |
|
| Q |
118 |
tccgaaacttcccacaaagccatagtcattgatgtctcctctgagaaagtcaatcatctccttgataagtctcatccttgggctaaccgtattgagtttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19388275 |
tccgaaacttcccacaaagccatagtcattgatgtctcctctgagaaagtcaatcatctccttgataagtctcatccttgggctaaccgtattgagtttc |
19388374 |
T |
|
| Q |
218 |
atcagatgaatatcaagaacgattctcgtcttgaaactcttgtcaaagcttctgatctcgtatata |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19388375 |
atcagatgaatatcaagaacgattctcgtcttgaaactcttgtcaaagcttctgatctcgtatata |
19388440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University