View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_27 (Length: 361)
Name: NF1412_low_27
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_27 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 15 - 344
Target Start/End: Complemental strand, 416793 - 416464
Alignment:
| Q |
15 |
ttcactgacaaagaagaattcagagttgcattctccggataatcggtacttctgactgagctaggcattccaacagctgcttcgctactcaattcactgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
416793 |
ttcactgacaaagaagaattcagagttgcattctccggataatcggtacttctgactgtgctgggcattccaacagctgcttcgctactcaattcactgg |
416694 |
T |
 |
| Q |
115 |
aagtggtctgatcacaacaaaaagcttgtcatcagttcaatgtactaaaggcatgaatcaagtgaataagatgctgttttagtttggtaaactgtttaaa |
214 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
416693 |
aaatggtctgatcacaacaaaaagcttgtcatcagttcaatgtactaaaggcatgaatcaagtgaacaagatgctgttttagtttggtaaactgtttaaa |
416594 |
T |
 |
| Q |
215 |
cgaagggtttcccacattaaattggtttttaagatggtgatcatattgccacgaagaaggaggaaaaaagggtaaatggggtcaagttacttatattttg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
416593 |
cgaagggtttcccacattaaattggtttttaagatggtgatcatattgccacgaagaaggaggaaaaaagggtaaatggggtcaagttacttatattttg |
416494 |
T |
 |
| Q |
315 |
catcaccaaaccaagcacaacggactttat |
344 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
416493 |
catcaccaaaccaagcacgacggactttat |
416464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University