View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_45 (Length: 315)
Name: NF1412_low_45
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 208 - 290
Target Start/End: Complemental strand, 41733179 - 41733097
Alignment:
| Q |
208 |
ttcattaaccttgtaaatgtattttacatgtcttgtaaacatggtttgaaaagtgatattatgaaattattaaagttgattga |
290 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41733179 |
ttcattaaccttgtaattgtattttgcatgtcttgtaaacatggtttgaaaagtgatattatgaaattattaaagttgattga |
41733097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University