View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_49 (Length: 303)
Name: NF1412_low_49
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 10 - 182
Target Start/End: Complemental strand, 30188233 - 30188061
Alignment:
| Q |
10 |
attattctttaccattcattaggtgagggaacaaaatgatccttctttgcatgtaatccaaagcgagatgttactataaaatgggagtatttgacttaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30188233 |
attattctttaccattcattaggtgagggaacaaaatgatccttctttgcatgtaatccaaagcgagatgttactataaaatgggagtatttgacttaaa |
30188134 |
T |
|
| Q |
110 |
aatcaaactgaaagactctcatgcattgttttactttagatagataccatgtgtcattgtcaaagatacatgg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30188133 |
aatcaaactgaaagactctcatgcattgttttactttagatagataccatgtgtcattgtcaaagatacatgg |
30188061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 245 - 286
Target Start/End: Complemental strand, 30187998 - 30187957
Alignment:
| Q |
245 |
aacagaactgttgcattgtaaaccaaataatagaagcaatac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30187998 |
aacagaactgttgcattgtaaaccaaataatagaagcaatac |
30187957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University