View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1412_low_52 (Length: 294)

Name: NF1412_low_52
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1412_low_52
NF1412_low_52
[»] chr8 (3 HSPs)
chr8 (50-278)||(6046510-6046740)
chr8 (221-278)||(6062753-6062810)
chr8 (220-278)||(6087931-6087989)


Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 50 - 278
Target Start/End: Complemental strand, 6046740 - 6046510
Alignment:
50 atcatattgaagattcatctctactatttattcat-atttcatacttcttattatttggctagggatgattctcaagtcat-cagtgcattgtgagtgat 147  Q
    |||||||| ||||||||||| |||||||| ||||| | ||||||||| | ||||||||||||||||||| ||||||||||| ||| ||||||| ||||||    
6046740 atcatattcaagattcatctttactatttgttcattaattcatacttttaattatttggctagggatgactctcaagtcattcagagcattgtcagtgat 6046641  T
148 gttttgaaaaagctagccttgatgtatcccaatgaactgaaaggccttgttcataatgatcaacacggtagttatactgagtcactactgaaaagatatc 247  Q
    |||| |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||     
6046640 gtttggaaaaagctagccttgatgtatcctaatgaactgaaaggccttgttcataacgatcaacacggtagttatactgagtcactgctgaaaagatatt 6046541  T
248 caagaattggaatttggggcatgggtggaat 278  Q
    |||||||||||||||||||||||||||||||    
6046540 caagaattggaatttggggcatgggtggaat 6046510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 6062810 - 6062753
Alignment:
221 atactgagtcactactgaaaagatatccaagaattggaatttggggcatgggtggaat 278  Q
    ||||||| |||||||||||||  |||| |||||||||||||||||||||||| |||||    
6062810 atactgaatcactactgaaaaagtatcaaagaattggaatttggggcatgggaggaat 6062753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 6087989 - 6087931
Alignment:
220 tatactgagtcactactgaaaagatatccaagaattggaatttggggcatgggtggaat 278  Q
    |||||||| |||||||||||||  |||| |||||||||||| ||||||||||| |||||    
6087989 tatactgaatcactactgaaaaagtatcaaagaattggaatatggggcatgggaggaat 6087931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University