View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_58 (Length: 277)
Name: NF1412_low_58
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 14 - 262
Target Start/End: Original strand, 7471393 - 7471641
Alignment:
| Q |
14 |
gagattccaccttaagcgcgtatttggaagcaatataaccaccaaaagaatgccctagaagtataaaattgctcaggtttttggctttcctccattcctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7471393 |
gagattccaccttaagcgcgtatttggaagcaatataaccaccaaaagaatgccctagaagtataaaattgctcaggtttttggctttcctccattcctc |
7471492 |
T |
 |
| Q |
114 |
aaaagaatcaatgaaccaagcctcggtttctatacagtatcaataattaatttagcattttgctttgcaacaagataaaacttttgcaatatcatattaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7471493 |
aaaagaatcaatgaaccaagcctcggtttctatacagtatcaataattaatttagcattttgctttgcaacaagataaaacttttgcaatatcatattaa |
7471592 |
T |
 |
| Q |
214 |
ctaactctagcattcaccttcagtgcttttgcatgtaaagtctggcctg |
262 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7471593 |
ctatctctagcattcaccttcagtgcttttgcatgtaaagtctggcctg |
7471641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 22 - 144
Target Start/End: Original strand, 52872423 - 52872545
Alignment:
| Q |
22 |
accttaagcgcgtatttggaagcaatataaccaccaaaagaatgccctagaagtataaaattgctcaggtttttggctttcctccattcctcaaaagaat |
121 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||| || || ||||| |||||| | || ||||||||||| ||||||||||| ||||||| |
|
|
| T |
52872423 |
accttgagcgcgtatttggaagcaacataaccaccaaaagaatgtccaagcagtatgaaattggtaagatttttggcttttctccattcctcgaaagaat |
52872522 |
T |
 |
| Q |
122 |
caatgaaccaagcctcggtttct |
144 |
Q |
| |
|
|||||||||| ||||| |||||| |
|
|
| T |
52872523 |
caatgaaccatgcctcagtttct |
52872545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University