View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_66 (Length: 259)
Name: NF1412_low_66
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_66 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 113 - 242
Target Start/End: Complemental strand, 18423750 - 18423621
Alignment:
| Q |
113 |
gagtgaaaatttatcataaatctattatgttttacatatcttttaatagagaccaccttattctaacaccataagccccacgtattatttttaaataaaa |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18423750 |
gagtgaaagtttatcataaatctattatgttttacatattatttaatagagaccaccttattctaacaccataagccccacgtattatttttaaataaaa |
18423651 |
T |
 |
| Q |
213 |
atgcaacaattaatcaaatacttcaagatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18423650 |
atgcaacaattaatcaaatacttcaagatg |
18423621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 189 - 242
Target Start/End: Complemental strand, 22912652 - 22912599
Alignment:
| Q |
189 |
cccacgtattatttttaaataaaaatgcaacaattaatcaaatacttcaagatg |
242 |
Q |
| |
|
||||| ||| || ||||||||| ||| |||||| |||||||||||||||||||| |
|
|
| T |
22912652 |
cccacatataatatttaaataataattcaacaaataatcaaatacttcaagatg |
22912599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 239
Target Start/End: Complemental strand, 31326099 - 31326062
Alignment:
| Q |
202 |
tttaaataaaaatgcaacaattaatcaaatacttcaag |
239 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
31326099 |
tttaattataaatgcaacaattaatcaaatacttcaag |
31326062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University