View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_78 (Length: 249)
Name: NF1412_low_78
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 4 - 248
Target Start/End: Complemental strand, 52807359 - 52807115
Alignment:
| Q |
4 |
gagtgagatgaactataaagaaagcagtgaggcatagttattgttatttctaaagcctgtttactagagctctttcattctctctcactcattgaaactc |
103 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807359 |
gagtgacaagaactataaagaaagcagtgaggcatagttattgttatttctaaagcctgtttactagagctctttcattctctctcactcattgaaactc |
52807260 |
T |
 |
| Q |
104 |
tttaagctagttccacgtttctttgatagaaaaacaaaagagagtaactaaactaaactagcttccaaagacaaagagggaagtgtatagggggtgtgta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807259 |
tttaagctagttccacgtttctttgatagaaaaacaaaagagagtaactaaactaaactagcttccaaagacaaagagggaagtgtatagggggtgtgta |
52807160 |
T |
 |
| Q |
204 |
tatatcaagtgatgcgctcaggaggttgtgcattgcagcagaccc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807159 |
tatatcaagtgatgcgctcaggaggttgtgcattgcagcagaccc |
52807115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University