View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_87 (Length: 245)
Name: NF1412_low_87
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_87 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 28274445 - 28274684
Alignment:
| Q |
1 |
taggcaattcaggttaattatagagtgcttgtcactaacacttctctaaacccttttcaggttagtgttgcatatgaatcgagcgagatatcatcattta |
100 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274445 |
tagggaattcaggttaattattgagtgcttgtcactaacacttctctaaacccttttcaggttagtgttgcatatgaatcgagcgagatatcatcattta |
28274544 |
T |
 |
| Q |
101 |
ttgatgaacgcctggggtcttatccatttgagcatgcagagaagtttttaaatttggccctaaagtgttgcgaagatgagccagagccgcgtcctaaaat |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274545 |
ttgatgaacgcatggggtcttatccatttgagcatgcagagaagtttttaaatttggccctaaagtgttgcgaagatgagccagagccgcgtcctaaaat |
28274644 |
T |
 |
| Q |
201 |
ggcagaagtggttagagaacttgaagatatttgttctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274645 |
ggcagaagtggttagagaacttgaagatatttgttctgtg |
28274684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University