View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_89 (Length: 244)
Name: NF1412_low_89
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 12807961 - 12808190
Alignment:
| Q |
1 |
taaatatatgcaaaaagttgaaggaaatttcatataccctatttgcaaaaagggttctgcttgaatatccatactcatattcatagggttagtttgaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12807961 |
taaatatatgcaaaaagttgaaggaaatttcacgtaccctatttgcaaaaagggttctgcttggatatccatactcatattcatagggttagtttgaggc |
12808060 |
T |
 |
| Q |
101 |
tgctgaaaggtaaagttgcaatttccagcaactgaattagagctccacaaactttccattgctttgagattaaatccctctccttcaagctgaaaatgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
12808061 |
tgctgaaaggtaaagttgcaatttccagcaactgaattagagctccataaactttccattgctttaagattaaatccctctccttcaagctgaaaatgca |
12808160 |
T |
 |
| Q |
201 |
gttttgaaccatagaattaatagagaaatt |
230 |
Q |
| |
|
|||||| | |||| |||||||||||||||| |
|
|
| T |
12808161 |
gttttggagcataaaattaatagagaaatt |
12808190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 204
Target Start/End: Complemental strand, 28475793 - 28475727
Alignment:
| Q |
138 |
tagagctccacaaactttccattgctttgagattaaatccctctccttcaagctgaaaatggagttt |
204 |
Q |
| |
|
|||| |||||||| ||||| || ||||| ||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
28475793 |
tagaactccacaagctttcaatagctttaagattaaatccatctgattcaagctgaaaatgaagttt |
28475727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University