View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_92 (Length: 243)
Name: NF1412_low_92
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 3 - 148
Target Start/End: Complemental strand, 46254559 - 46254418
Alignment:
| Q |
3 |
gtgatttatttaaaatcagagtaggtaaaattactctcttgatctttaacttaatttcaaataagaannnnnnnnnnncatgtcattttgatcctttgca |
102 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46254559 |
gtgatttatttaaaatcagagtaggcaaaattactttcttgatctttaacttaatttcaaataa----ttttttttttcatgtcattttgatcctttgca |
46254464 |
T |
|
| Q |
103 |
tatgtattttcaaaaatataaatctacatttacatatgaattataa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46254463 |
tatgtattttcaaaaatataaatctacatttacatatgaattataa |
46254418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 46253625 - 46253564
Alignment:
| Q |
140 |
gaattataaatttaaaacttaaaaattgatacacaaatggatttaaaggatgaagtgaatat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46253625 |
gaattataaatttaaaacttaaaaattgatacacaaatggatttaaaggatgaagtgaatat |
46253564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 42106126 - 42106166
Alignment:
| Q |
141 |
aattataaatttaaaacttaaaaattgatacacaaatggat |
181 |
Q |
| |
|
||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
42106126 |
aattataaatttaaaacttgaaaatttatatacaaatggat |
42106166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University