View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1412_low_96 (Length: 237)
Name: NF1412_low_96
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1412_low_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 49646996 - 49647214
Alignment:
| Q |
1 |
tacagggagcaagctaattccatgttagtctctaagctcacctttgcaatcttcctcattagcaaatcagccttatccctcactcttgctgagcctctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49646996 |
tacagggagcaagctaattccatgttagtctctaagctcacctttgcaatcttcctcattagcaaatcagccttatccctcactcttgctgagcctctta |
49647095 |
T |
 |
| Q |
101 |
cagaaatatcagccaacagacttgagaattctgacaacatgaaagcctctctaacacattcatcactgtcatcaaaaagtcgaacaagaatatcaactgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49647096 |
cagaaatatcagccaacagacttgagaattctgaaaacatgaaagcctctctaacacattcatcactgtcatcaaaaagtcgaacaagaatatcaactgc |
49647195 |
T |
 |
| Q |
201 |
accttccttacacaacaaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49647196 |
accttccttacacaacaaa |
49647214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University