View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1412_low_98 (Length: 236)

Name: NF1412_low_98
Description: NF1412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1412_low_98
NF1412_low_98
[»] chr7 (1 HSPs)
chr7 (10-91)||(21216515-21216596)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 21216515 - 21216596
Alignment:
10 cgaagaaaatgtaactccaaaaagagtctctttcatcctatcattatgacatgcaccatcaataacgttgaatttgctcgga 91  Q
    |||||| |||||| |||||||||||||||||||||||||||||  ||||||||| ||||||||||||| |||||| ||||||    
21216515 cgaagagaatgtagctccaaaaagagtctctttcatcctatcagcatgacatgcgccatcaataacgtcgaatttactcgga 21216596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University