View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14130_high_11 (Length: 270)
Name: NF14130_high_11
Description: NF14130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14130_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 6725428 - 6725678
Alignment:
| Q |
1 |
acacatgttttgccccaacgtatgcaataacaagccattactgatcatgcatggaatacggtatgtgttccccttacaaaaatatacggtgtgtgcttgt |
100 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6725428 |
acacaggttttgccacaacgtatgcaataacaagccattactgatcttgcatggaatacggtatgtgttccccttacaaaaatatacggtgtgtgcttgt |
6725527 |
T |
 |
| Q |
101 |
tttatcaattctcataaacaaattaatatataatgtgcagacatgaccatcatgcatgttatttcaccgtgagcctcttggaaacgcagttagctagcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6725528 |
tttatcaattctcataaacaaattaatatataatgtgcagacatgaccatcatgcatgttatttcaccgtgagcctcttggaaacgcagttagctagcta |
6725627 |
T |
 |
| Q |
201 |
ggtttcaaaagatatatcattgcttgcttgtttaatcatatcctacttcct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6725628 |
ggtttcaaaagatatatcattgcttgcttgtttaatcatatcctacttcct |
6725678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University