View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14130_high_12 (Length: 262)

Name: NF14130_high_12
Description: NF14130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14130_high_12
NF14130_high_12
[»] chr4 (2 HSPs)
chr4 (18-203)||(55076966-55077151)
chr4 (31-87)||(42340914-42340970)
[»] chr6 (2 HSPs)
chr6 (19-119)||(15124833-15124933)
chr6 (28-132)||(10932546-10932650)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 55077151 - 55076966
Alignment:
18 attgccaccatacacttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccac 117  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55077151 attgccaccatacacttcacgacccatccaatcagtatcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccac 55077052  T
118 attggtttctttaatccactaaaagcacttaacaactccccgaagcagccgacgtcatcctataaattatcaacattgactattgt 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||| |||||    
55077051 attggtttctttaatccactaaaagcacttaacaactccccgaagcagccgacgtcatcctataaattacaaacattgacaattgt 55076966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 42340970 - 42340914
Alignment:
31 acttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaa 87  Q
    |||||||| |||||||||||||||| ||| ||  ||||| |||||||||| ||||||    
42340970 acttcacggcccatccaatcagtgttgaataaagaaaataggaaccatgcaacccaa 42340914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 119
Target Start/End: Original strand, 15124833 - 15124933
Alignment:
19 ttgccaccatacacttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccaca 118  Q
    |||||||| || |||||  |||||||||||||||||||||||||||| || || |||||||| |||||||| || ||||| || | ||| ||||||||||    
15124833 ttgccaccgtatacttcttgacccatccaatcagtgtcgaacaagaagaacggaaaccatgcaacccaattgatcgcggtaaccaacatcagcatccaca 15124932  T
119 t 119  Q
    |    
15124933 t 15124933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 132
Target Start/End: Complemental strand, 10932650 - 10932546
Alignment:
28 tacacttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccacattggtttct 127  Q
    ||||| ||||| |||||||| ||||||||||||||||| || |||||||| || | ||| || |  || ||||||| ||| |  |||||||||||| |||    
10932650 tacacctcacggcccatccagtcagtgtcgaacaagaagaacgggaaccacgcgatccagttcacggctgttactaacatcaatatccacattggtctct 10932551  T
128 ttaat 132  Q
    |||||    
10932550 ttaat 10932546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University