View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14130_high_15 (Length: 220)
Name: NF14130_high_15
Description: NF14130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14130_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 36638594 - 36638798
Alignment:
| Q |
1 |
gattgatgtgtgtttacttgtacattgcagaaattttgcttccattgccatggtcgataagaatgaagattgcatatggcgctgcaaagggacttgcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36638594 |
gattgatgtgtgtttacttgtacattgcagaaattttgcttcccttgccatggtcgataagaatgaagattgcatatggcgctgcaaagggacttgcatt |
36638693 |
T |
 |
| Q |
101 |
tcttcatgaagcnnnnnnncccgtcatctatcgtgattttaagacatcgaatattttattggacctggttagtattagtatacatcaagatttaatgtca |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36638694 |
tcttcatgaagcaaaaaaacccgtcatctatcgtgattttaagacatcgaatattttattggacctggttagtattagtatacatcaagacttaatgtca |
36638793 |
T |
 |
| Q |
201 |
atgtt |
205 |
Q |
| |
|
||||| |
|
|
| T |
36638794 |
atgtt |
36638798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University