View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14130_low_13 (Length: 262)
Name: NF14130_low_13
Description: NF14130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14130_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 55077151 - 55076966
Alignment:
| Q |
18 |
attgccaccatacacttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55077151 |
attgccaccatacacttcacgacccatccaatcagtatcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccac |
55077052 |
T |
 |
| Q |
118 |
attggtttctttaatccactaaaagcacttaacaactccccgaagcagccgacgtcatcctataaattatcaacattgactattgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
55077051 |
attggtttctttaatccactaaaagcacttaacaactccccgaagcagccgacgtcatcctataaattacaaacattgacaattgt |
55076966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 42340970 - 42340914
Alignment:
| Q |
31 |
acttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaa |
87 |
Q |
| |
|
|||||||| |||||||||||||||| ||| || ||||| |||||||||| |||||| |
|
|
| T |
42340970 |
acttcacggcccatccaatcagtgttgaataaagaaaataggaaccatgcaacccaa |
42340914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 119
Target Start/End: Original strand, 15124833 - 15124933
Alignment:
| Q |
19 |
ttgccaccatacacttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccaca |
118 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||||||||||||||| || || |||||||| |||||||| || ||||| || | ||| |||||||||| |
|
|
| T |
15124833 |
ttgccaccgtatacttcttgacccatccaatcagtgtcgaacaagaagaacggaaaccatgcaacccaattgatcgcggtaaccaacatcagcatccaca |
15124932 |
T |
 |
| Q |
119 |
t |
119 |
Q |
| |
|
| |
|
|
| T |
15124933 |
t |
15124933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 132
Target Start/End: Complemental strand, 10932650 - 10932546
Alignment:
| Q |
28 |
tacacttcacgacccatccaatcagtgtcgaacaagaaaaatgggaaccatgctacccaatttatagcggttactatcattagcatccacattggtttct |
127 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||| || |||||||| || | ||| || | || ||||||| ||| | |||||||||||| ||| |
|
|
| T |
10932650 |
tacacctcacggcccatccagtcagtgtcgaacaagaagaacgggaaccacgcgatccagttcacggctgttactaacatcaatatccacattggtctct |
10932551 |
T |
 |
| Q |
128 |
ttaat |
132 |
Q |
| |
|
||||| |
|
|
| T |
10932550 |
ttaat |
10932546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University