View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14130_low_16 (Length: 226)
Name: NF14130_low_16
Description: NF14130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14130_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 13 - 179
Target Start/End: Complemental strand, 13275056 - 13274890
Alignment:
| Q |
13 |
gagcacagagatagtacagagtgtttttgctgcttctgtattattcatggtaaaggaggagcttgttaaggctatcacgtttatagcaaataagagcaaa |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13275056 |
gagcacaaagatagtacagagtgtttttgctgcttctgtattattcatggtaaaggaggagcttgttaaggctatcacagttatagcaaataagagcaaa |
13274957 |
T |
 |
| Q |
113 |
aaagttgtattaaattcgagtagttaacttgactttcttcttttcgttatagaaataatacaagtag |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13274956 |
aaagttgtattaaattcgagtagttaacttgactttcttcttttcgttatagaaataatacaagtag |
13274890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University