View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14130_low_18 (Length: 203)
Name: NF14130_low_18
Description: NF14130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14130_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 133 - 188
Target Start/End: Complemental strand, 30325301 - 30325246
Alignment:
| Q |
133 |
gggaggatatgcggaaattgatggatataatggtaaaaatgattgaggagtataat |
188 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30325301 |
gggaggatatgtggaaattgatggatataatggtaaaaatgattgaggagtataat |
30325246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 180
Target Start/End: Complemental strand, 30336885 - 30336850
Alignment:
| Q |
145 |
ggaaattgatggatataatggtaaaaatgattgagg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30336885 |
ggaaattgatggatataatggtaaaaatgattgagg |
30336850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University