View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14131_low_15 (Length: 291)
Name: NF14131_low_15
Description: NF14131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14131_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 57 - 276
Target Start/End: Original strand, 32119463 - 32119682
Alignment:
| Q |
57 |
tatacgaaatgtgtacggtatcaaagtatggcatgtttgagaggagataatatcaaagttttacccgagaaagtagaaaggaagccggttgtggtaatga |
156 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32119463 |
tatacgaaatgtgtacggtatcaaagtctggcatgtttgagaggagataatatcaaagttttacccgagaaagtagaaaggaagccggtggtggtaatga |
32119562 |
T |
|
| Q |
157 |
aggcaaccatgactaccaccaataacttaaccatatcgcaaccagcactggttcctcaaggattgtcggaattattagctgagatcatagcaagtattcg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32119563 |
aggcaaccatgactaccaccaataacttaaccatatcgcaaccagcactggttcctcaaggattgtcggaattattagctgagatcgtagcaagtattcg |
32119662 |
T |
|
| Q |
257 |
caatgctatgctggtggttc |
276 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32119663 |
caatgctatgctggtggttc |
32119682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University