View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14131_low_16 (Length: 275)
Name: NF14131_low_16
Description: NF14131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14131_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 28661383 - 28661143
Alignment:
| Q |
17 |
atatactgcatcttatgatttcttttgttaatgtaatgagacaaaagtcttatacctacctacttatggtccaaatcacttttttaattaattaattcnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28661383 |
atatactgcatcttatgatttcttttgttaatgtaatgagacaaaagtcttatacctacctacttatggtccaaatcacttttttaattaattaattcct |
28661284 |
T |
 |
| Q |
117 |
nnnnnnnnagtgatattggtctttgtcaatttttgtccttgttatgttccatgatctagaattattagattcttctcataatccatgaaggtttgtacac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28661283 |
tttttt--agtgatattggtctttgtcaatttttgtccttgttatgtttcatgatctagaattattagattcttctcataatccatgaaggtttgtacac |
28661186 |
T |
 |
| Q |
217 |
cctcataaagcagtaattcttctatcctatctatcactttcat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28661185 |
cctcataaagcagtaattcttctatcctatctatcactttcat |
28661143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University