View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14131_low_23 (Length: 222)
Name: NF14131_low_23
Description: NF14131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14131_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 51276819 - 51277016
Alignment:
| Q |
11 |
attattcttcaaaagcaataatcaatatactaattaggaggcatgcagtgaattataaatataccaattaattacatggatggaaattaactcacagaat |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51276819 |
attattattcaaaagcaataatcaatatactaattaggaggcatgcagtgaattataaatatactaattaattacatggatggaaattaactcacagaat |
51276918 |
T |
 |
| Q |
111 |
ttttatcatatagcatttcatcaacttgtactagtttttgcagtgcaactttcccttccatttttgtagcaaaaatatatgaatgatggatgcagcct |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51276919 |
ttttatcatatagcctttcatcaacttgtactagtttttgcagtgcaactttcccttcaatttttgtagcaacaatatatgaatgatggatgcagcct |
51277016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University