View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14131_low_5 (Length: 553)
Name: NF14131_low_5
Description: NF14131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14131_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 5e-82; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 379 - 537
Target Start/End: Original strand, 4885073 - 4885231
Alignment:
| Q |
379 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggtgtagggagaggcat |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4885073 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggcgtagggagaggcat |
4885172 |
T |
|
| Q |
479 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttag |
537 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885173 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttag |
4885231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 167 - 319
Target Start/End: Original strand, 4884861 - 4885013
Alignment:
| Q |
167 |
caaccgttatagatgatttgttggtgactcagaaatactctccaaatgaggtctccacacagcaacacgtcctcttcttctatctctctgactacaaacc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4884861 |
caaccgttatagatgatttgttggtgactcagaaatactctccaaatgaggtctccacacagcaacacgtcctcttcttctgtctctctgactacaaacc |
4884960 |
T |
|
| Q |
267 |
ttctcagacagaatctcagtcaagtactgatcagaagacacaaccaacgtagc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4884961 |
ttctcagacagaatctcagtcaagtactgatcagaagaaacaaccaacgtagc |
4885013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 11 - 46
Target Start/End: Original strand, 4884704 - 4884739
Alignment:
| Q |
11 |
aaaattgaaagaaacaaagtttattttcttctttac |
46 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4884704 |
aaaattgacagaaacaaagtttattttcttctttac |
4884739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University