View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14132_high_13 (Length: 371)
Name: NF14132_high_13
Description: NF14132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14132_high_13 |
 |  |
|
| [»] scaffold0627 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 4e-57; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 169 - 289
Target Start/End: Original strand, 55321757 - 55321876
Alignment:
| Q |
169 |
caattcaagatagatatttcatttatcttcttctcgaactcctgaatttgtacaaaagaacaattataaatttgaataaccataatacttttatataaat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55321757 |
caattcaagatagatatttcatttatcttcttctcgaactcctgaatttgtacaaaagaacaattataaatttgaataaccataatac-tttatataaat |
55321855 |
T |
 |
| Q |
269 |
aatgagatcttatagtcttat |
289 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
55321856 |
aatgagatcttatagtcttat |
55321876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 55321315 - 55321409
Alignment:
| Q |
1 |
agaaagattagacattcaaaattcatttaccttattgtgcaaggataactgacttgagatcattcactaattcctaccctgattgcatgtttaac |
95 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55321315 |
agaaagattagacattcaaaattaatttaccttattgtgcaaggataactgacttgagatcattcactaattcctgccctgattgcatgtttaac |
55321409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 266 - 355
Target Start/End: Complemental strand, 56226555 - 56226466
Alignment:
| Q |
266 |
aataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||| ||||| ||| |||||||| |||| |||||| ||||||| |||||| ||||||||||||||||||| |||||| | ||||||| |
|
|
| T |
56226555 |
aataattagatcctatggtcttattaaatctaatggttaaataaagtggtacatcggtgagagacttaattgatccctcatcttagaatc |
56226466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 14527582 - 14527620
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
14527582 |
caccggtgagggacttaattgatccctcaccctagaatc |
14527620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 18363659 - 18363697
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18363659 |
caccggtgaggaacttaattgaaccctcaccctagaatc |
18363697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 313 - 355
Target Start/End: Complemental strand, 20143325 - 20143283
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||||||||| |
|
|
| T |
20143325 |
ggtacaccggtgagggacttagttgagccctcaccctagaatc |
20143283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 24666171 - 24666133
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
24666171 |
caccggtgagggacttaattgatccctcaccctagaatc |
24666133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 313 - 355
Target Start/End: Original strand, 26393400 - 26393442
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
26393400 |
ggtacaccggtgagggacttaatagagccctcaccctagaatc |
26393442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 36599269 - 36599231
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36599269 |
caccggtgaggaacttaattgaaccctcaccctagaatc |
36599231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 34450857 - 34450820
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
34450857 |
caccggtgagggacttaattgatccctcaccctagaat |
34450820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 322 - 355
Target Start/End: Complemental strand, 34941539 - 34941506
Alignment:
| Q |
322 |
gtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
34941539 |
gtgagggacttaattgaaccctcaccctagaatc |
34941506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 45394023 - 45393986
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
45394023 |
caccggtaagagacttaattgaaccctcactctagaat |
45393986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 47156675 - 47156638
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
47156675 |
caccgatgagggacttaattgaaccctcaccctagaat |
47156638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Original strand, 47157385 - 47157422
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |
|
|
| T |
47157385 |
caccggtgagggatttaattgaaccctcaccctagaat |
47157422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 355
Target Start/End: Original strand, 56227030 - 56227099
Alignment:
| Q |
286 |
ttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||| ||||||| ||| ||||||| ||||||||||||| ||||| ||||| ||||||| |||||||| |
|
|
| T |
56227030 |
ttattaaatccaacggttaaataaagtggtacaccggtgaaggacttcattgagccctcactctagaatc |
56227099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 317 - 353
Target Start/End: Original strand, 26354238 - 26354274
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaa |
353 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
26354238 |
cacctgtgagggacttaattgaaccctcaccctagaa |
26354274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 7e-34; HSPs: 12)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 262 - 355
Target Start/End: Original strand, 29595545 - 29595638
Alignment:
| Q |
262 |
tataaataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
29595545 |
tataaataatgagatcttatagtcttatttaatctaatggtcaaataaactggtacactggtgagggacttaattgaaccctcacgctagaatc |
29595638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 265 - 355
Target Start/End: Complemental strand, 29595000 - 29594910
Alignment:
| Q |
265 |
aaataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| || ||| |||||||||||||||||| |||||||| |||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
29595000 |
aaataatgagttcatatggtcttatttaatccaatgaccaaataaagtggtacatcggtgaagaacttaattgaaccctcaccctagaatc |
29594910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 308
Target Start/End: Complemental strand, 7806518 - 7806475
Alignment:
| Q |
265 |
aaataatgagatcttatagtcttatttaatccaatggtcaaata |
308 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7806518 |
aaataaggagatcctatagtcttatttaatccaatggtcaaata |
7806475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 289 - 355
Target Start/End: Original strand, 27345897 - 27345963
Alignment:
| Q |
289 |
tttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||| ||||| || |||| | ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27345897 |
tttaatccaatgatcaaaataagtggtatatcggtgagggacttaattgaaccctcaccctagaatc |
27345963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 2029053 - 2029091
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
2029053 |
caccggtgagggacttaattgagccctcaccctagaatc |
2029091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 23253492 - 23253530
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
23253492 |
caccggtgagggacttaattggaccctcaccctagaatc |
23253530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 24565615 - 24565577
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
24565615 |
caccggtgagggatttaattgaaccctcaccctagaatc |
24565577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 24606651 - 24606613
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
24606651 |
caccggtgagggatttaattgaaccctcaccctagaatc |
24606613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 35524883 - 35524921
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
35524883 |
caccggtgagaaacttaattgatccctcaccctagaatc |
35524921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 39937912 - 39937950
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
39937912 |
caccggtgagggacttaactgaaccctcaccctagaatc |
39937950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 40372166 - 40372204
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40372166 |
caccggtgaggaacttaattgaaccctcaccctagaatc |
40372204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 39466927 - 39466890
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
39466927 |
caccggtgagggacttaattggaccctcaccctagaat |
39466890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 4e-29; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 262 - 355
Target Start/End: Complemental strand, 33321594 - 33321501
Alignment:
| Q |
262 |
tataaataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
33321594 |
tataaataatgagatcttatagtcttatttaatccaatggtcaaataaattggtacatcagtgagggacttaattgaaccatcaccttagaatc |
33321501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 265 - 355
Target Start/End: Original strand, 33322157 - 33322247
Alignment:
| Q |
265 |
aaataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||||||||||||||| |||||| ||||| || |||||||||||||| ||||||||| |
|
|
| T |
33322157 |
aaataatgagttcatatgttcttatttaatccaatggtcaaataaagttgtacacatgtgagggatataattgaaccctcatcctagaatc |
33322247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 313 - 355
Target Start/End: Original strand, 16911048 - 16911090
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
16911048 |
ggtacaccggtgagggacttaattgagccctcaccctagaatc |
16911090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 4402293 - 4402331
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4402293 |
caccggtgagggacttaatagaaccctcaccctagaatc |
4402331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 22632364 - 22632326
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
22632364 |
caccggtgagggacttaattgatccctcaccctagaatc |
22632326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 22632974 - 22633012
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
22632974 |
caccggtgagggacttaattgatccctcaccctagaatc |
22633012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 26847139 - 26847101
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
26847139 |
caccggtgagggacttaattggaccctcaccctagaatc |
26847101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 42094051 - 42094013
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
42094051 |
caccggtgagggacttaattgatccctcaccctagaatc |
42094013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 42663319 - 42663281
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
42663319 |
caccggtgagagacttaattggactctcaccctagaatc |
42663281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 202619 - 202582
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
202619 |
caccggtgagggacttaattgaaccctcatcctagaat |
202582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 317456 - 317419
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
317456 |
caccggtgagggacttaattgaaccctcatcctagaat |
317419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 36180729 - 36180692
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
36180729 |
caccggtgagggacttaattaaaccctcaccctagaat |
36180692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 6e-22; HSPs: 12)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 262 - 355
Target Start/End: Complemental strand, 3315052 - 3314959
Alignment:
| Q |
262 |
tataaataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||||||||| ||| || | ||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
3315052 |
tataaataatgagatagtatggtttcatttaatccaatggttaaataaagtggtacaccggtgagggacttaattgaaccctcaccgtagaatc |
3314959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 265 - 355
Target Start/End: Original strand, 3315417 - 3315507
Alignment:
| Q |
265 |
aaataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| || ||| |||||||||||||| ||||| |||| || | || ||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
3315417 |
aaataatgagttcatatggtcttatttaatccgatggttaaattaagtgttataccggtgagggacttaattgagccctcaccttagaatc |
3315507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 36611500 - 36611538
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36611500 |
caccggtgagagatttaattgaaccctcaccctagaatc |
36611538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 317 - 354
Target Start/End: Complemental strand, 36611593 - 36611556
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36611593 |
caccggtgagggacttaattgaaccctcaccctagaat |
36611556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 317 - 354
Target Start/End: Original strand, 42818559 - 42818596
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42818559 |
caccggtgagggacttaattgaaccctcaccctagaat |
42818596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 320 - 355
Target Start/End: Complemental strand, 30580674 - 30580639
Alignment:
| Q |
320 |
cggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30580674 |
cggtgagagacttaattaaaccctcaccctagaatc |
30580639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 767178 - 767140
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
767178 |
caccggtgagggacttaattggaccctcaccctagaatc |
767140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 17114187 - 17114149
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
17114187 |
caccgatgagggacttaattgaaccctcaccctagaatc |
17114149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 41965783 - 41965821
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
41965783 |
caccggtgagggacttaattggaccctcaccctagaatc |
41965821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 46491694 - 46491732
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
46491694 |
caccggtgagggacttagttgaaccctcaccctagaatc |
46491732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 321 - 354
Target Start/End: Original strand, 30581276 - 30581309
Alignment:
| Q |
321 |
ggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
30581276 |
ggtgagggacttaattgaaccctcaccctagaat |
30581309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 317 - 353
Target Start/End: Original strand, 7329074 - 7329110
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaa |
353 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
7329074 |
caccagtgagggacttaattgaaccctcaccctagaa |
7329110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 16)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 266 - 355
Target Start/End: Complemental strand, 54308546 - 54308457
Alignment:
| Q |
266 |
aataatgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||| |||| |||||||||| || ||||||| || ||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54308546 |
aataatgagatcaaataggattatttaatctaacggtcaaaataagtggttcaccggtgagggacttaattgaaccctcaccctagaatc |
54308457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 313 - 355
Target Start/End: Complemental strand, 20807983 - 20807941
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20807983 |
ggtacaccggtgagggacttaattgaaccctcaccctagaatc |
20807941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 286 - 354
Target Start/End: Original strand, 18745345 - 18745413
Alignment:
| Q |
286 |
ttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||||| | ||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
18745345 |
ttatttaatctaatggtcaaattcagtggtgcaccggtgagggacttgattgaaccctcaccctagaat |
18745413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 313 - 355
Target Start/End: Original strand, 4706958 - 4707000
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4706958 |
ggtacaccggtgagggacttaatagaaccctcaccctagaatc |
4707000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 313 - 355
Target Start/End: Original strand, 20808609 - 20808651
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
20808609 |
ggtacaccggtgagggacttacttgaaccctcaccctagaatc |
20808651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 323 - 356
Target Start/End: Original strand, 43479523 - 43479556
Alignment:
| Q |
323 |
tgagagacttaattgaaccctcaccctagaatct |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43479523 |
tgagagacttaattgaaccctcaccctagaatct |
43479556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 33762690 - 33762733
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatct |
356 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
33762690 |
ggtacaccggtgagggacttaatagaaccctcaccttagaatct |
33762733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 9830614 - 9830576
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
9830614 |
caccggtgagggacttaattgaaccctcacccgagaatc |
9830576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 15287609 - 15287571
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
15287609 |
caccggtgagggacttaattggaccctcaccctagaatc |
15287571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 47571238 - 47571200
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
47571238 |
caccggtgagggacttaattgatccctcaccctagaatc |
47571200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 49349718 - 49349680
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
49349718 |
caccggtgagggacttaattgatccctcaccctagaatc |
49349680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 49350276 - 49350314
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
49350276 |
caccggcgagggacttaattgaaccctcaccctagaatc |
49350314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 313 - 355
Target Start/End: Complemental strand, 54751842 - 54751800
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
54751842 |
ggtacaccgatgagagacttatttgaaccctcatcctagaatc |
54751800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Original strand, 29516555 - 29516592
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
29516555 |
caccggtgagggacttaattgaaccctcaccgtagaat |
29516592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Original strand, 47571945 - 47571982
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
47571945 |
caccggtgagggacttaattgatccctcaccctagaat |
47571982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 286 - 354
Target Start/End: Complemental strand, 18744693 - 18744625
Alignment:
| Q |
286 |
ttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||||| | ||| |||||||||| ||||| ||| |||||||| |||||||| |
|
|
| T |
18744693 |
ttatttaatctaatggtcaaatttagtggtgcaccggtgagggacttgattaaaccctcatcctagaat |
18744625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 13)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 271 - 356
Target Start/End: Complemental strand, 32772188 - 32772103
Alignment:
| Q |
271 |
tgagatcttatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatct |
356 |
Q |
| |
|
||||||| ||||| ||||||||||| ||||||||| |||| |||||| ||||||| | ||||||||| |||||||| |||||||| |
|
|
| T |
32772188 |
tgagatcatatagacttatttaatctaatggtcaattaaagtggtacatcggtgaggggcttaattgagccctcaccttagaatct |
32772103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 265 - 347
Target Start/End: Complemental strand, 11937795 - 11937711
Alignment:
| Q |
265 |
aaataatgagatcttatagtcttatttaatccaatggtcaaataaa--cgggtacaccggtgagagacttaattgaaccctcacc |
347 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||| | |||||||||||||| || |||||||| ||| |||| |
|
|
| T |
11937795 |
aaataaggagatcatatagtcttatttaatccaatggtcaaatatagtgtggtacaccggtgagggatttaattgagcccccacc |
11937711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 279 - 355
Target Start/End: Complemental strand, 27745636 - 27745560
Alignment:
| Q |
279 |
tatagtcttatttaatccaatggtcaaataaacgggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||| ||||||||||| |||| |||| |||| |||| | ||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
27745636 |
tatagacttatttaatctaatgatcaattaaagtggtatatcggtgagggacttaattgaaccctcaccttagaatc |
27745560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 16449597 - 16449559
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16449597 |
caccggtgagggacttaattgaaccctcaccctagaatc |
16449559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 16459171 - 16459133
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16459171 |
caccggtgagggacttaattgaaccctcaccctagaatc |
16459133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 313 - 355
Target Start/End: Complemental strand, 24847829 - 24847787
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
24847829 |
ggtacaccggtgagggacttaatagaaccctcaccctagaatc |
24847787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 313 - 355
Target Start/End: Original strand, 24848428 - 24848470
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
24848428 |
ggtacaccggtgagggacttaatagaaccctcaccctagaatc |
24848470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 26240877 - 26240915
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26240877 |
caccggtgagggacttaattgaaccctcaccctagaatc |
26240915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 2260899 - 2260856
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaatct |
356 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
2260899 |
ggtataccggtgagggacttgattgaaccctcaccctagaatct |
2260856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 318 - 357
Target Start/End: Original strand, 14166914 - 14166953
Alignment:
| Q |
318 |
accggtgagagacttaattgaaccctcaccctagaatctg |
357 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14166914 |
accggtgagggacttaattgagccctcaccctagaatctg |
14166953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 26240156 - 26240118
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
26240156 |
caccggtgagggacttaattgatccctcaccctagaatc |
26240118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 313 - 353
Target Start/End: Original strand, 16450467 - 16450507
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaa |
353 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
16450467 |
ggtacaccagtgagggatttaattgaaccctcaccctagaa |
16450507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 313 - 353
Target Start/End: Original strand, 16460043 - 16460083
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaa |
353 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
16460043 |
ggtacaccagtgagggatttaattgaaccctcaccctagaa |
16460083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 313 - 354
Target Start/End: Original strand, 13084881 - 13084922
Alignment:
| Q |
313 |
ggtacaccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13084881 |
ggtacaccggtgagagacttagttgaaccctcaccctagaat |
13084922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 308
Target Start/End: Original strand, 8555064 - 8555107
Alignment:
| Q |
265 |
aaataatgagatcttatagtcttatttaatccaatggtcaaata |
308 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8555064 |
aaataaggagatcctatagtcttatttaatccaatggtcaaata |
8555107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 317 - 354
Target Start/End: Original strand, 20606927 - 20606964
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20606927 |
caccggtgagggacttaattgaaccctcaccctagaat |
20606964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 356
Target Start/End: Original strand, 30514551 - 30514587
Alignment:
| Q |
320 |
cggtgagagacttaattgaaccctcaccctagaatct |
356 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30514551 |
cggtgagagacttaattgaatcctcaccctagaatct |
30514587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 127741 - 127779
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
127741 |
caccggtgaaggacttaattgaaccctcaccctagaatc |
127779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 320 - 354
Target Start/End: Original strand, 44297423 - 44297457
Alignment:
| Q |
320 |
cggtgagagacttaattgaaccctcaccctagaat |
354 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44297423 |
cggtgagggacttaattgaaccctcaccctagaat |
44297457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 44987545 - 44987583
Alignment:
| Q |
317 |
caccggtgagagacttaattgaaccctcaccctagaatc |
355 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
44987545 |
caccagtgagagacttaattgatccctcaccctagaatc |
44987583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0627 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0627
Description:
Target: scaffold0627; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 320 - 353
Target Start/End: Complemental strand, 6503 - 6470
Alignment:
| Q |
320 |
cggtgagagacttaattgaaccctcaccctagaa |
353 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
6503 |
cggtgagggacttaattgaaccctcaccctagaa |
6470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University