View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14132_high_31 (Length: 219)
Name: NF14132_high_31
Description: NF14132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14132_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 37306920 - 37307097
Alignment:
| Q |
15 |
caaagggggttttcattgctactaaaggtttaaaggaacttaatctgcaacaacatcccgaggccactactgttctgtggggttgaattgattttttggt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37306920 |
caaaaggggttttcattgctactaaaggtttaaaggaacttaatctgcaacaacatcccgaggccactactgttatgtggggttgaattgattttttggt |
37307019 |
T |
 |
| Q |
115 |
tttaagagatggaaagttgcaggaaatgagattgggtttagctacaactagcaccataatcacaagggggtgcaaatt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37307020 |
tttaagagatggaaagttgcaggaaatgagattgggtttagctacaactagcaccataatcacaagggggtgcaaatt |
37307097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University