View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14132_high_33 (Length: 210)
Name: NF14132_high_33
Description: NF14132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14132_high_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 22269768 - 22269575
Alignment:
| Q |
1 |
atgattttgagtgttgtgtnnnnnnnntaatacaggaggaagattcagaagagtatggaagtccggtggtttcggcatctactattgctgacattataaa |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22269768 |
atgattttgagtgttgtgtaaaaaaaataatacaggaggaagattcagaagagtatggaagtccggtggtttcggcatctactattgctgacattataaa |
22269669 |
T |
|
| Q |
101 |
gtctcgaaccgaagcacttttgaagataaccaaaacagcagtttctcctaagccaattgtgctcaaagctgaatacgcacactgtccaaatctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22269668 |
gtctcgaaccgaagcacttttgaagataaccaaaacagcagtttctcctaagccaattgtgctcaaagctgaatacgcacactgtccaaatctt |
22269575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University