View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14132_low_18 (Length: 356)
Name: NF14132_low_18
Description: NF14132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14132_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 8e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 41743908 - 41743816
Alignment:
| Q |
18 |
tttctaatgtgttcttttatatacacgtgtaaaagatattcccagtaccacatctatgaacggagtttgttcttgtaaactaaaaagattcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41743908 |
tttctaatgtgttcttttatatacacgtgtaaaagatattaccagtaccacatctatgaacggagtttgttcttgtaaactaaaaagattcat |
41743816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University