View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14132_low_26 (Length: 282)
Name: NF14132_low_26
Description: NF14132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14132_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 35187033 - 35186767
Alignment:
| Q |
1 |
taaaacacttgaacatctt---gttttattgaaaagattagaagaattgtagaagagaatatagtaaggggtggacccagactggaaagtttagaggggc |
97 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35187033 |
taaaacacttgaacatcttcttgttttattgaaaagattagaagaattgtagaagagaatatagtaaggggtggacccagactggaaagttgagaggggc |
35186934 |
T |
 |
| Q |
98 |
caaaacaaaaccaagtcaatatagttactaacctacatgctacaaccacgttgcactatctcaattcagctttcattcggtgtatgttgctttc------ |
191 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35186933 |
caaaacaaaaccaagtc---------actaacctacatgctacaaccacgttggactatctcaattcagctttcattcggtgtatgttgctttcattttt |
35186843 |
T |
 |
| Q |
192 |
atttttattaagagaaatggtaattgcaaacgctcaaacaatcgtcttttaacacacgcctatctatctatctgtg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35186842 |
atttttattaagagaaatggtaattgcaaacgctcaaacaatcgtcttttaacacacgcctatctatccatctgtg |
35186767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University