View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14132_low_35 (Length: 219)

Name: NF14132_low_35
Description: NF14132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14132_low_35
NF14132_low_35
[»] chr3 (1 HSPs)
chr3 (15-192)||(37306920-37307097)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 37306920 - 37307097
Alignment:
15 caaagggggttttcattgctactaaaggtttaaaggaacttaatctgcaacaacatcccgaggccactactgttctgtggggttgaattgattttttggt 114  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
37306920 caaaaggggttttcattgctactaaaggtttaaaggaacttaatctgcaacaacatcccgaggccactactgttatgtggggttgaattgattttttggt 37307019  T
115 tttaagagatggaaagttgcaggaaatgagattgggtttagctacaactagcaccataatcacaagggggtgcaaatt 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37307020 tttaagagatggaaagttgcaggaaatgagattgggtttagctacaactagcaccataatcacaagggggtgcaaatt 37307097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University