View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14134_low_1 (Length: 699)
Name: NF14134_low_1
Description: NF14134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14134_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 4e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 566 - 678
Target Start/End: Complemental strand, 14203416 - 14203301
Alignment:
| Q |
566 |
ttattagaaccgtaaaatcacaccactttcgaacgatcgtgatataataataat---tgggcaagtggatttagcctttaagcatcattagaaagtagca |
662 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||| | |
|
|
| T |
14203416 |
ttattagaaccgtaaaatcacaccactttcgaacgatcgtgatataataataataattgggcaagtggctttagcctttaagcatcataagaaagtagta |
14203317 |
T |
|
| Q |
663 |
gagacagaaatgacac |
678 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14203316 |
gagacagaaatgacac |
14203301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 39 - 150
Target Start/End: Complemental strand, 14203524 - 14203412
Alignment:
| Q |
39 |
aaccaataattt-gttaataattaaattggtcacggtaaatgatacaattgataaatcattacttacactgggaagagaagcacaaacaacaaagacaga |
137 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
14203524 |
aaccaataattttgttaataattaaattggtcattgtaaatgatacaattaataaatcattacttacattgggaagagaagcacaaacaacaaagataga |
14203425 |
T |
|
| Q |
138 |
ttgaagatttatt |
150 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14203424 |
ttgaagatttatt |
14203412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University