View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14134_low_6 (Length: 235)
Name: NF14134_low_6
Description: NF14134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14134_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 40523247 - 40523381
Alignment:
| Q |
1 |
agtgcaatgataattaattgcgaagttgcatgatatg------gttatataaggtaacgtgcttaaaaacaatttattttgtttgattaagtacaaaatc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40523247 |
agtgcaatgataattaattgcgaagttgcatgatatggttatggttatataaggtaacgtgcttaaaaacaatttattttgtttgattaagtacaaaatc |
40523346 |
T |
|
| Q |
95 |
caccaccnnnnnnnttaagtgcaaaatctagcctt |
129 |
Q |
| |
|
||||||| |||||| |||||||||||||| |
|
|
| T |
40523347 |
caccaccaaaaaaattaagtacaaaatctagcctt |
40523381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University