View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14135_low_2 (Length: 210)
Name: NF14135_low_2
Description: NF14135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14135_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 55088682 - 55088877
Alignment:
| Q |
1 |
ccgtacgtacactgaaaacgaaaaggatcataacaatcacacgtttgcatgttatgggggctttatagatgatgcaataaggttaaaagacatagcaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55088682 |
ccgtacgtacactgaaaacgaaaaggatcatcacaatcacacgtttgcatgttatgggg-ctttatagatgatgcaataaggttaaaaaacatagcaatg |
55088780 |
T |
 |
| Q |
101 |
ctaaatgcatcagcaattaat---cacacatccatgcatatacatatgcccctcctctctttctgcctctattagcaagttaattgacattattggt |
194 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55088781 |
ctaaatgcatcagcaattaataatcacacatccatgcatatacatatgcccctcctctctttctgcctctattagcaagttaattgacattattggt |
55088877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University