View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14136_high_14 (Length: 227)

Name: NF14136_high_14
Description: NF14136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14136_high_14
NF14136_high_14
[»] chr8 (1 HSPs)
chr8 (121-227)||(43833045-43833151)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 121 - 227
Target Start/End: Original strand, 43833045 - 43833151
Alignment:
121 agtcgaaaacaacaatttgtagagacaatagcttactattttattgctcgaaacaatttgatgcacttctaaaatttatcatcaaatatcatcaacaaat 220  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
43833045 agtcgaaaacaacaatttgtagagacaataacttactattttattgcttgaaacaatttgatgcacttctaaaatttatcatcaaatatcatcaacaaat 43833144  T
221 gataaat 227  Q
    |||||||    
43833145 gataaat 43833151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University