View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14136_high_14 (Length: 227)
Name: NF14136_high_14
Description: NF14136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14136_high_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 121 - 227
Target Start/End: Original strand, 43833045 - 43833151
Alignment:
| Q |
121 |
agtcgaaaacaacaatttgtagagacaatagcttactattttattgctcgaaacaatttgatgcacttctaaaatttatcatcaaatatcatcaacaaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43833045 |
agtcgaaaacaacaatttgtagagacaataacttactattttattgcttgaaacaatttgatgcacttctaaaatttatcatcaaatatcatcaacaaat |
43833144 |
T |
 |
| Q |
221 |
gataaat |
227 |
Q |
| |
|
||||||| |
|
|
| T |
43833145 |
gataaat |
43833151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University