View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14136_high_3 (Length: 371)
Name: NF14136_high_3
Description: NF14136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14136_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 364
Target Start/End: Complemental strand, 29451739 - 29451376
Alignment:
| Q |
1 |
cgtttccacgtgagagaatttcttaggagtaagaaggtctttatcaacaaccttaagtgcaaaatttgcaccgtcgtagtcacggaggcgacatagaaac |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451739 |
cgtttccgcgtgagagaatttcttaggagtaagaaggtctttatcaacaaccttaagtgcaaaatttgcaccgtcgtagtcacggaggcgacatagaaac |
29451640 |
T |
 |
| Q |
101 |
acacggccgaggtcaccggagccaaggtggcggataagctttaaatgacggagatgaagtctcccatcagaggagagattggtggctgcttttattgctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451639 |
acacggccgaggtcaccggagccaaggtggcggataagctttaaatgacggagatgaagtctcccatcagaggagagattggtggctgcttttattgctg |
29451540 |
T |
 |
| Q |
201 |
tccagttggagtctgagcttcggtgaggacggcggatgacagcggatgagacggtgtctccggcggtggaggcggttgagagacggtcgttgaaactaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29451539 |
tccagttggagtctgagcttcggtgaggacggcggatgacagcggatgagacggtgtctccggcggtggaggcggtggagagacggtcgttgaaactaag |
29451440 |
T |
 |
| Q |
301 |
agcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcggtctgtggtg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
29451439 |
agcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcgttcagtggtg |
29451376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University