View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14136_high_8 (Length: 268)
Name: NF14136_high_8
Description: NF14136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14136_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 8894046 - 8893808
Alignment:
| Q |
18 |
acatgtcaatctcaatgcaattcacaatcttcataaggaatccaaacaagcgagtatccatttactttgacaggctttccacctttgtgtcatatagaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8894046 |
acatgtcaatctcaatgcaattcacaatcttcataaggaatccaaacaagcgagtatccatttactttgacaggctttccacctttgtgtcatatagaaa |
8893947 |
T |
 |
| Q |
118 |
ccatccgattacacctcatcatatgcttccgtcgctttacttggagaagcatgaaaccgtgtcggtatcaccagttttaggaggcgtgccggttccagtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8893946 |
ccatccgattacacctcatcatatgcttccgtcgctttacttggagaagcatgaaaccgtgtcggtatcaccagttttaggaggcgtgccggttccagtt |
8893847 |
T |
 |
| Q |
218 |
tcggtggatgttttgaatggtttggtgttggatgagaat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8893846 |
tcggtggatgttttgaatggtttggtgttggatgagaat |
8893808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University