View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14136_low_15 (Length: 237)

Name: NF14136_low_15
Description: NF14136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14136_low_15
NF14136_low_15
[»] chr4 (2 HSPs)
chr4 (42-174)||(23598489-23598620)
chr4 (132-192)||(24564294-24564353)
[»] chr7 (1 HSPs)
chr7 (1-33)||(30180660-30180692)


Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 42 - 174
Target Start/End: Original strand, 23598489 - 23598620
Alignment:
42 ggtagaaaaataagaagagaaacaggttacccaagtccagtgatgttttaaaatgatgtttgatggttaattggtcaagagagacaaagtgaagctactg 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23598489 ggtagaaaaataagaagagaaacaggttacccaagtccagtgatgttttaaaatgatgtttgatggttaattggtcaagagagacaaagtgaagctactg 23598588  T
142 taagtatttttgtactcttgactcgttcaaaca 174  Q
    ||||||||||||||||| |||||||||||||||    
23598589 taagtatttttgtactc-tgactcgttcaaaca 23598620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 132 - 192
Target Start/End: Original strand, 24564294 - 24564353
Alignment:
132 gaagctactgtaagtatttttgtactcttgactcgttcaaacaattttcaacattagaaat 192  Q
    ||||||||| |||||||||| ||||||| ||||| |||||||||||||||||| |||||||    
24564294 gaagctactataagtattttagtactct-gactcattcaaacaattttcaacactagaaat 24564353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 30180660 - 30180692
Alignment:
1 tttcaaatagatgttcaaagatcactactctaa 33  Q
    ||||||||||||||||||| |||||||||||||    
30180660 tttcaaatagatgttcaaatatcactactctaa 30180692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University