View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14136_low_8 (Length: 276)
Name: NF14136_low_8
Description: NF14136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14136_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 7646003 - 7645754
Alignment:
| Q |
11 |
gatgaagaaggatttggagggatatatagtggaaaccaatcccttcagaaagataagtccgtccatgaaaatcacccaggttataattagttaatttgct |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7646003 |
gatgaagaaggatttggagggatatatggtggaaaccaatcccttcagaaagataagtccgtccatgaaaatcacccaggttataattagttaatttgct |
7645904 |
T |
 |
| Q |
111 |
tatgatcatacatggacaactagnnnnnnnccttacgtttaaaacattttacaccgtcaatttcttattacttttgtagaggtcatgatggaaattaatt |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7645903 |
tatgatcatacatggacaactagtttttttccttacgtttaaaacattttacaccgtcattttcttattacttttgtagaggtc---atggaaattaatt |
7645807 |
T |
 |
| Q |
211 |
attaagcctaattcagacttgtttgtttttgtgcatgaagattatgacaagac |
263 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7645806 |
attaagcctaattaagacttgtttgtttttgtgcatgaagattatgacaagac |
7645754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University