View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14137_high_4 (Length: 209)
Name: NF14137_high_4
Description: NF14137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14137_high_4 |
 |  |
|
| [»] scaffold0302 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 9 - 188
Target Start/End: Complemental strand, 1236568 - 1236389
Alignment:
| Q |
9 |
aggagcacagatggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcgagc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1236568 |
aggatcacagatggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcgagc |
1236469 |
T |
 |
| Q |
109 |
tttgtgttgctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctatgcagtttgctggttgcagc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1236468 |
tttgtgttgctgttgggtgtgtttttagtgtgtcggggagttttccttctggcggtcctatgcagtttgctggttgcagc |
1236389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 98 - 188
Target Start/End: Original strand, 1183239 - 1183328
Alignment:
| Q |
98 |
tttttgcgagctttgtgttgctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctatgcagtttgctggttgcagc |
188 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||||| |||| |||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
1183239 |
tttttgcgcgcttcatgttgctgttgaatgtgtttttagtgtcgaggg-agttttccttctggtggtcctatgcagtttgctggctgcagc |
1183328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 1183182 - 1183244
Alignment:
| Q |
21 |
ggatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttttg |
83 |
Q |
| |
|
||||| |||| |||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
1183182 |
ggatggcaatagaatatctaggttttgatatagataatgtaggtctgctaagttctgtttttg |
1183244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 105
Target Start/End: Original strand, 1194054 - 1194111
Alignment:
| Q |
48 |
atgtagataatgcaggtctgcaaagttctgtttttgtagctgttgcactctttttgcg |
105 |
Q |
| |
|
||||||||||||||| ||||| |||||| ||||||||||||||||| | |||||||| |
|
|
| T |
1194054 |
atgtagataatgcagttctgccgagttctatttttgtagctgttgcagtatttttgcg |
1194111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 188
Target Start/End: Original strand, 1194126 - 1194170
Alignment:
| Q |
144 |
gggagttttccttctggcggtcctatgcagtttgctggttgcagc |
188 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
1194126 |
gggatttttccttctggtggtcctatgcagtttgctggctgcagc |
1194170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: scaffold0302
Description:
Target: scaffold0302; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 22 - 181
Target Start/End: Original strand, 20346 - 20509
Alignment:
| Q |
22 |
gatgacaattgaatatctaggttttgatgtagataatgcaggtctgcaaagttctgtttt----tgtagctgttgcactctttttgcgagctttgtgttg |
117 |
Q |
| |
|
|||| |||| |||||||||||||| |||| |||||||||||||||| ||||||||||| |||| ||||||| || |||||| | |||| |||||| |
|
|
| T |
20346 |
gatggcaatagaatatctaggtttcaatgtggataatgcaggtctgccgagttctgttttattttgtacctgttgcgctatttttgtgtgcttcgtgttg |
20445 |
T |
 |
| Q |
118 |
ctgttgggtgtgtttttagtgtgtaggggagttttccttctggcggtcctatgcagtttgctgg |
181 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
20446 |
ttgttgggtgtgtttttagtgtgctggggatttttccttctggtggtcctatacagtttgctgg |
20509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University