View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_28 (Length: 351)
Name: NF14138_high_28
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 193 - 341
Target Start/End: Complemental strand, 36422096 - 36421948
Alignment:
| Q |
193 |
ccacgcacgatagaagtaaagagatctgtcttctgatttgaattacacaagttgtgtctgtgtgctagctgctttcttcctgattttactgcttacgtgg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422096 |
ccacgcacgatagaagtaaagagatctgtcttctgaattgaattacacaagttgtgtctgtgtgctagctgctttcttcctgattttactgcttacgtgg |
36421997 |
T |
 |
| Q |
293 |
ttcaatatcaatataccacgtgtcccgacttcactttcaccacaatatt |
341 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36421996 |
ttcaatatcaatataccacgtgtcccaacttcactttcaccacaatatt |
36421948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 36422302 - 36422174
Alignment:
| Q |
1 |
aatgaagtgcgaacctcgatcagtggtgaatgtgtgactcagtttgnnnnnnnnnnnnctacttttgtgaaggagaaagaaagaaaga--------gagt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
36422302 |
aatgaagtgcgaacctcgatcagtggtgaatgtgtgactcagtttgttttttatttttctacttttgtgaaggagaaagaaagaaagaaagaaagagagt |
36422203 |
T |
 |
| Q |
93 |
gaaaatgtaagtaaattaaattaggatta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36422202 |
gaaaatgtaagtaaattaaattaggatta |
36422174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University