View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_32 (Length: 307)
Name: NF14138_high_32
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 145 - 290
Target Start/End: Original strand, 36422584 - 36422729
Alignment:
| Q |
145 |
attggttacatttcttgtgtttcattgaagtcattgattctactgagctcaattttgtctacaaaggggtttttggtttttaataggggataaccgataa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36422584 |
attggttacatttcttgtgtttcattgaagtcattgattctactgagctcaattttgtctacaaaggggtttttggtttttaataggggataactgataa |
36422683 |
T |
 |
| Q |
245 |
gctagttcatgctgatgagcttatagcaaatagcttataaccgata |
290 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
36422684 |
gctagttcatggggacgagcttatagcaaatagcttataaccgata |
36422729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 6 - 73
Target Start/End: Original strand, 36422445 - 36422512
Alignment:
| Q |
6 |
gctgagtttgaatccacattaaggatgtcaattgggaaaaagctctgataatgtaatttaagctctca |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422445 |
gctgagtttgaatccacattaaggatgtcaattgggaaaaagctctgataatgtaatttaagctctca |
36422512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University