View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_41 (Length: 257)
Name: NF14138_high_41
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 42033603 - 42033845
Alignment:
| Q |
1 |
ccgtcttccaggttcattttgtggaacataaaaaataaacccatctt-agcttaacgtggtggttattacctcttgannnnnnnnactcaagatgagaat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42033603 |
ccgtcttccaggttcattttgtggaacataaaaaataaacccatctttagcttaacgtggtggttattacctcttgattttttttactcaagatgagaat |
42033702 |
T |
|
| Q |
100 |
atattattggatatatgatcgaatccaatgttcctttttgtccttggaatcttggtagtgttaggtggtggaagcttcttcctcggtgctaatgacatga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033703 |
atattattggatatatgatcgaatccaatgttcctttttgtccttggaatcttggtagtgttaggtggtggaagcttcttcctcggtgctaatgacatga |
42033802 |
T |
|
| Q |
200 |
tccttctcatatcatcaactcaatttagtactattgatgttgt |
242 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42033803 |
tccttcttatatcatcaactcaatttagtaccattgatgttgt |
42033845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University