View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_42 (Length: 255)
Name: NF14138_high_42
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 38883243 - 38883461
Alignment:
| Q |
1 |
taatttctgctcagttttgtgttttatgatgttctgattttgcttcattgtagggttgacatgttattcttattatccatgttggtgttctgcaacagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883243 |
taatttctgctcagttttgtgttttatgatgttctgattttgcttcattgtagggttgacatgttattcttattatccatgttggtgttctgcaacagca |
38883342 |
T |
 |
| Q |
101 |
ttatgtcctttgtggcaacatcatcagtttgcacactctccatccccctaaaggttttcagttggaaatctatgctagcattgtggtcattgtctttcta |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883343 |
ttacgtcctttgtggcaacatcatcagtttgcatactctccatccccctaaaggttttcagttggaaatctatgctagcattgtggtcattgtctttcta |
38883442 |
T |
 |
| Q |
201 |
cctgttaagttgcttcttg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38883443 |
cctgttaagttgcttcttg |
38883461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University