View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_46 (Length: 250)
Name: NF14138_high_46
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 42033622 - 42033376
Alignment:
| Q |
1 |
aaaatgaacctggaagacggtgttgccgtatatagtcatagttatgcacccaattgcagtatggaggaacattcgtaatcaacaattcaacatgcttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42033622 |
aaaatgaacctggaagacggtgttgccgtatatagtcatagttatgcacccaattgcagtatggaggaacattcgtaatcaacaattcaacatgcttcat |
42033523 |
T |
 |
| Q |
101 |
tattgctccaaagtcttgtacattgctccatttgctaaatctctcaaccgatacatttacattccgaatcaatcacaata-----gtatgtatcatttgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42033522 |
tattgctccaaagtcttgtacattgctccatttgctaaatctctcaaccgatacatttacattccgaatcaatcacaatagtatagtatgtatcatttgt |
42033423 |
T |
 |
| Q |
196 |
ttgtatgtaaacaaaatnnnnnnntctatttacctcattttcatatc |
242 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42033422 |
ttgtatgtaaacaaaataaaaaaatctatttacctcattttcatatc |
42033376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University