View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_51 (Length: 246)
Name: NF14138_high_51
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 35 - 99
Target Start/End: Original strand, 16149627 - 16149691
Alignment:
| Q |
35 |
ggtcaaccatagtccatatatagactcttagggcgtcggcttgtgcatgttgattgaattttata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16149627 |
ggtcaaccatagtccatatatagactcttagggcgtcggcttgtgcatgttgattgaattttata |
16149691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 170 - 224
Target Start/End: Original strand, 16150062 - 16150116
Alignment:
| Q |
170 |
tttgtgagctgttaaactagttgaaagaaaaatgataaactgcgagaaataagtg |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16150062 |
tttgtgagctgttaaactagctgaaagaaaaatgataaacagcgagaaataagtg |
16150116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University