View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_53 (Length: 239)
Name: NF14138_high_53
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 96 - 221
Target Start/End: Original strand, 4382566 - 4382691
Alignment:
| Q |
96 |
ggcccgggaggatagaaggaaattcttcagtgtaaagaaagagaaagagggttgtgaagaatacttgaagcaaaatatgagtcttagctgtgtggttgtc |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4382566 |
ggcccgggcggatagaaggaaattcttcagtgtaaagaaagagaaagagggctgtgaagaatacttgaagcaaaatatgagtcttagctgtgtggttgtc |
4382665 |
T |
 |
| Q |
196 |
gaaatatacagaaggtgtgcagggag |
221 |
Q |
| |
|
|||||||||||||| ||||| ||||| |
|
|
| T |
4382666 |
gaaatatacagaagttgtgcggggag |
4382691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 4382388 - 4382467
Alignment:
| Q |
1 |
tgtacaacatggatatatttttacagggggaacgagaaccttgttattcaggtctttatttggaccaagtagacacaaca |
80 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4382388 |
tgtacaacatggatatatttttacagggacaacgagaaccttgttattcaggtctttatttggaccaagtagacacaaca |
4382467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 61 - 101
Target Start/End: Original strand, 4382472 - 4382512
Alignment:
| Q |
61 |
tggaccaagtagacacaacaatggaacggcttttgggcccg |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4382472 |
tggaacaagtagacacaacaatggaacggcttttgggcccg |
4382512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 214
Target Start/End: Complemental strand, 4112663 - 4112597
Alignment:
| Q |
148 |
tgtgaagaatacttgaagcaaaatatgagtcttagctgtgtggttgtcgaaatatacagaaggtgtg |
214 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||| | |||||||||||||||| | |||| ||||| |
|
|
| T |
4112663 |
tgtgaggaatacttgaaacaaaatatgaggtttagttttgtggttgtcgaaataaaaagaaagtgtg |
4112597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University