View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14138_high_58 (Length: 233)
Name: NF14138_high_58
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14138_high_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 10369229 - 10369032
Alignment:
| Q |
13 |
gatgaacatgaatgaagaaataatgaagattggagatgttactgtcttcaaagatagagttgaagatggtgttgtttttagagtaaatatctttttggcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10369229 |
gatgaacatgaatgaagaaataatgaagattggagatggtactgtcttcaaagatagagttgaagatggtgttgtttttagagtaaatatctttttggcc |
10369130 |
T |
 |
| Q |
113 |
tctctccaagggtgacaaannnnnnnnnnnnnnnnnnnnnnatgtgtatagtcttgaacgaatatatttggactctatctgcacaaatgatatattaa |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10369129 |
tctctccaagggtgacaaatttgttgtttttgttttgttttatgtgtatagtcttgaacgaatatatttggactctatctgcacaaatgacatattaa |
10369032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University